Nanotechnology

Enzyme-less nanopore detection of post-translational modifications within long polypeptides


Construction of Trx-linker concatemer genes

All the reagents were purchased from New England Biolabs (NEB) and DNA oligonucleotides were obtained from Integrated DNA Technologies, unless otherwise indicated. Trx-linker concatemer genes were prepared as previously described29. Briefly, the Trx-linker monomer gene was amplified with a 5′ primer containing a BamHI restriction site and a 3′ primer containing a BglII restriction site, which permitted the in-frame cloning of the monomer into the vector pQE30 (QIAGEN). Synthetic genes encoding the concatemers were then constructed by the iterative cloning of monomer into monomer, dimer into dimer and tetramer into tetramer. To aid purification, an N-terminal SUMO tag was inserted between the His6 tag and the first monomer unit. In addition, N-terminal cysteine-glycine codons were included to give the final concatemer constructs: His6-SUMO-CysGly-(Trx-linker)n (n = 2, 4, 6) and His6-SUMO-CysGly-(Trx-linker)7Trx.

To produce Trx-linker nonamers (His6-SUMO-(Trx-linker)n, n = 9) containing a modification site, the N-terminal cysteine-glycine codons were removed from the tetramer gene and a DNA cassette was designed to contain two terminal restriction sites (BamHI and BglII) and two internal restriction sites (KpnI and AvrII) (5′-p GATCCGGTACCGGCGGTCCTAGG AGATCTGGCGGTA-3′ and 5′-p GCCATGGCCGCCAGGATCCTCTAGACCGCCATTCGA-3′). Using the interactive cloning strategy described above, a ‘cloneable’ Trx-linker octamer gene was assembled with the DNA cassette as the middle unit flanked by two Trx-linker tetramer genes (that is, the final construct is His6-SUMO-(Trx-linker)4-KpnI-AvrII-(Trx-linker)4). A Trx-linker monomer mutant gene encoding an RRASAC peptide motif was created by site-directed insertion (forward primer, 5′- AGCGCCTGCGCGGGTTCTGCTGGTTCC-3′; reverse primer, 5′-CGCACGGCG GCTCCCTGCACTTCCGGC-3′) and subsequently cloned in between the KpnI and AvrII sites within the Trx-linker octamer to give (Trx-linker)4-Trx-linker(RRASAC)-(Trx-linker)4. The placement of a single correctly oriented insert was confirmed by sequencing using primers targeting the KpnI and AvrII ligation sites (forward primer, 5′-TGCGAGCGCCTGCGGTGG-3′; reverse primer, 5′-ACGCTCGCGGACGCCACC-3′).

Expression and purification of Trx-linker concatemers

Genes encoding the N-terminal His6-SUMO-tagged concatemers of Trx were cloned into the pOP3SU plasmid (kindly provided by M. Hyvönen). BLR(DE3) competent cells (Novagen) were transformed with the plasmids and grown in a Luria broth medium supplemented with ampicillin (100 µg ml–1) at 37 °C with continuous shaking (250 r.p.m.). Protein expression was induced in the exponential growth phase (OD600 = 0.6) with isopropyl-β-d-1-thiogalactopyranoside (0.5 mM final concentration). After 8 h, the cells were harvested by centrifugation (10 min, 5,000×g), resuspended in a binding buffer (30 mM Tris HCl, 250 mM NaCl, 25 mM imidazole at pH 7.2) supplemented with a protease inhibitor cocktail (cOmplete, EDTA free; Roche) and lysed by sonication. Cell debris was removed by centrifugation at 20,000×g for 45 min, and the supernatant loaded onto a HisTrap HP column (5 ml, Cytiva) at 0.2 ml min–1. The column was washed with 50 ml of the binding buffer before single-step elution with 15 mL of 30 mM Tris HCl, 250 mM NaCl, 300 mM imidazole at pH 7.2. A single peak containing the almost pure protein was collected and dialysed (Slide-A-Lyzer G2 Dialysis Cassette, 10,000 molecular weight cutoff, 30 ml; Thermo Fisher) for 3 h against 4 l of dialysis buffer (50 mM Tris HCl, 250 mM NaCl, 2 mM 1,4-dithio-d-threitol (DTT) at pH 8.0), at 4 °C with continuous stirring, to remove excess imidazole. After injecting His6-tagged Ulp1 protease into the dialysis cassette at a molar concentration ratio of 1:200 (Ulp1:Trx-linker concatemer), the mixture was transferred into a fresh dialysis buffer overnight for SUMO-tag cleavage. The cassette was then transferred one last time into fresh dialysis buffer without DTT for 4 h. The dialysed protein was loaded onto a column packed with HisPur Ni-NTA Agarose Resin (5 ml, Thermo Fisher) equilibrated with a binding buffer (50 mM Tris HCl, 250 mM NaCl at pH 8.0) and the flow through was reapplied five more times. The final flow through containing the His6-SUMO-free protein was aliquoted and flash frozen for storage at −80 °C.

Expression and purification of SUMO protease Ulp1

The Pfget19_Ulp1 plasmid (Addgene) containing a His6-tagged Ulp1 gene was transformed into T7 Express competent cells (NEB) and grown in a Luria broth medium supplemented with kanamycin (100 μg ml–1) at 37 °C with shaking (250 r.p.m.). Expression was induced at OD600 = 0.5 with isopropyl-β-d-1-thiogalactopyranoside (0.5 mM). Cells were harvested after 3 h by centrifugation, resuspended in lysis buffer (4 ml g–1; 50 mM Tris HCl, 300 mM NaCl, 10 mM imidazole at pH 7.5) supplemented with lysozyme (1 mg ml–1) and incubated on ice for 30 min before sonication. The lysate was spun at 20,000 r.p.m. for 45 min to remove the cell debris and the supernatant was applied to a column packed with HisPur Ni-NTA Agarose Resin (5 ml, Thermo Fisher) and equilibrated with a binding buffer (50 mM Tris HCl, 300 mM NaCl at pH 7.5). The column was washed with 10 column volumes of wash buffer (50 mM Tris HCl, 300 mM NaCl, 20 mM imidazole at pH 7.5) and the protein was eluted with 10 ml of elution buffer (50 mM Tris HCl, 300 mM NaCl, 300 mM imidazole at pH 7.5). The eluted protein was dialysed against a storage buffer (50 mM Tris HCl, 200 mM NaCl, 2 mM 2-mercaptoethanol) overnight, aliquoted and flash frozen as a 50% stock in glycerol.

Phosphorylation of Trx-linker concatemers

Trx-linker concatemers (1 mg ml–1) were incubated with 50,000 units of the catalytic subunit of cAMP-dependent protein kinase (NEB)—which recognizes the RRAS motif within the central linker of the Trx-linker nonamer—in a protein kinase buffer (50.0 mM Tris HCl at pH 7.5,10.0 mM MgCl2, 0.1 mM EDTA, 4.0 mM DTT, 0.01% Brij 35 and 2.0 mM ATP) (NEB) at 30 °C for 1 h. The solution was then supplemented with additional ATP at a final concentration of 2 mM and DTT at a final concentration of 2 mM before overnight incubation at 30 °C. Trx-linker concatemers were purified and concentrated using centrifugal filters (Amicon Ultra 0.5 ml, 100 K), aliquoted and flash frozen for storage at −20 °C (10 mM HEPES at pH 7.2 and 750 mM KCl). Phosphorylation of the Trx-linker concatemers at a single site was verified by liquid chromatography–mass spectrometry.

Modification of cysteines on Trx-linker concatemers

Reagents were purchased from Sigma-Aldrich, unless otherwise indicated. Trx-linker nonamer was first treated with tris(2-carboxyethyl)phosphine (TCEP) (70 to 100 eq) at 32 °C for 2 h in a protein storage buffer (50 mM Tris HCl, 250 mM NaCl at pH 8.0). Excess TCEP was removed by a desalting column (PD MiniTrap G-25 column, Cytiva). To glutathionylate the Trx-linker nonamer, the reduced protein was reacted with oxidized glutathione (100 eq) at 32 °C overnight in a protein storage buffer (50 mM Tris HCl, 250 mM NaCl at pH 8.0) before desalting to remove the excess reagent. The modified protein was aliquoted and flash frozen for storage at −20 °C. To glycosylate the Trx-linker nonamers, the reduced protein was reacted first with 2,2′-dithiodipyridine (20 eq) at 32 °C overnight in the protein storage buffer (50 mM Tris HCl, 250 mM NaCl at pH 8.0). After the removal of excess 2,2′-dithiodipyridine with a desalting column, the activated nonamer was reacted with the 6′-sialyllactosamine derivative (NeuAcα(2-6)LacNAc-PEG3-Thiol, 5 eq; Sussex Research Laboratories) overnight at 32 °C in a protein storage buffer (50 mM Tris HCl, 250 mM NaCl at pH 8.0). Modified nonamers were desalted (PD MiniTrap G-25 column, Cytiva), aliquoted and flash frozen for storage at −20 °C. The occurrence of glutathionylation or glycosylation at single sites was verified by liquid chromatography–mass spectrometry.

Single-channel recording

Planar lipid bilayers of 1,2-diphytanoyl-sn-glycero-3-phosphocholine (Avanti Polar Lipids) were formed by using the Müller–Montal method on a 50-μm-diameter aperture made in a Teflon film (25 μm thick, Goodfellow) separating two 500 μl compartments (cis and trans) of the recording chamber. Each compartment was filled with a recording buffer (750 mM GdnHCl, 1.5 M GdnHCl, 3.0 M GdnHCl, 2.0 M urea/750 mM KCl or 750 mM KCl, 10 mM HEPES, 5 mM TCEP at pH 7.2 for Trx-linker dimer, tetramer, hexamer and octamer; 375 mM GdnHCl/375 mM KCl, 10 mM HEPES at pH 7.2 for Trx-linker nonamers). To record with Trx-linker dimer, tetramer, hexamer or octamer and ensure a reduced N-terminal cysteine, pretreatment of the protein samples with 5 mM TCEP was carried out for 10 min at room temperature. This pretreatment was not carried out with nonamers which lacked the N-terminal cysteine residue. Trx-linker concatemers were added to the cis compartment (dimer, 2.20 μM; tetramer, 0.63 μM; hexamer, 0.25 μM; octamer, 0.81 μM; nonamer, 1.20 μM). Ionic currents were measured at 24 ± 1 °C by using Ag/AgCl electrodes connected to the headstage of an Axopatch 200B amplifier. After a single (NN-113R)7 pore had inserted into the bilayer, the solution was replaced with a fresh buffer by manual pipetting, to prevent further insertions. Signals were low-pass filtered at 10 kHz and sampled at 50 kHz with a Digidata 1440A digitizer (Molecular Devices).

Data analysis

To establish the current signatures for the stepwise co-translocational unfolding of Trx concatemers, current traces were analysed using Clampfit 10.7 (Molecular Devices). The remaining current as a percentage of the open-pore current (Ires%) was calculated for each step in individual A or B features (for example, Ires%(A1) = IA1/Iopen × 100%). The standard deviations were derived from data for Trx-linker units collected using separate pores. Trx-linker units that produced a level A3 or B3 with a dwell time of <1 ms were excluded from the Ires% analysis due to possible undersampling. Root-mean-square noise values (Ir.m.s.) for each current level were measured from current traces after the application of a post-recording filter of 2 kHz. Unless otherwise stated, the noise of the open pore was subtracted as follows: Ir.m.s.2 = Ir.m.s.(A1)2 – Ir.m.s.(open pore)2. To obtain the stepwise kinetic profiles of the co-translocational unfolding of Trx concatemers, current traces were idealized using Clampfit 10.7. The dwell-time analysis was performed by using the maximum interval likelihood algorithm of QUB 2.0 software (https://qub.mandelics.com/).